The question
Name: ______________________ Date: ____________ Substitution versus frameshift: predict the protein (4 points)
Model
A short coding sequence and three mutations
The table shows the first part of a normal mRNA and three mutant versions, each with one change. A codon table, grouped by amino acid, follows.
| mRNA | Sequence | Change |
|---|---|---|
| Normal | AUG UUC GGA CAU UGG AAA CCG UAG GC | — |
| Mutation 1 | AUGUUUGGACAUUGGAAACCGUAGGC | C at position 6 replaced by U |
| Mutation 2 | AUGUAUCGGACAUUGGAAACCGUAGGC | A inserted after position 4 |
| Mutation 3 | AUGUUCAGACAUUGGAAACCGUAGGC | G at position 7 replaced by A |
| Amino acid | Codons |
|---|---|
| Alanine (Ala) | GCU, GCC, GCA, GCG |
| Arginine (Arg) | CGU, CGC, CGA, CGG, AGA, AGG |
| Asparagine (Asn) | AAU, AAC |
| Aspartic acid (Asp) | GAU, GAC |
| Cysteine (Cys) | UGU, UGC |
| Glutamine (Gln) | CAA, CAG |
| Glutamic acid (Glu) | GAA, GAG |
| Glycine (Gly) | GGU, GGC, GGA, GGG |
| Histidine (His) | CAU, CAC |
| Isoleucine (Ile) | AUU, AUC, AUA |
| Leucine (Leu) | UUA, UUG, CUU, CUC, CUA, CUG |
| Lysine (Lys) | AAA, AAG |
| Methionine (Met), also the start signal | AUG |
| Phenylalanine (Phe) | UUU, UUC |
| Proline (Pro) | CCU, CCC, CCA, CCG |
| Serine (Ser) | UCU, UCC, UCA, UCG, AGU, AGC |
| Threonine (Thr) | ACU, ACC, ACA, ACG |
| Tryptophan (Trp) | UGG |
| Tyrosine (Tyr) | UAU, UAC |
| Valine (Val) | GUU, GUC, GUA, GUG |
| Stop (no amino acid) | UAA, UAG, UGA |
(a) Describe the effect of mutation 1 on the polypeptide, and explain why it has that effect. [1 point]
(b) Predict the first five amino acids of the polypeptide made from mutation 2. [1 point]
(c) Explain why mutation 2 is more likely than mutation 3 to destroy the protein's function. [1 point]
(d) A different mutation inserts one A after position 18 instead of after position 4. Predict whether its effect on the protein would be larger or smaller than that of mutation 2, and justify your prediction. [1 point]